akt2 forward primer  (GenScript corporation)

Journal: Pharmaceutics

Article Title: ROS–Responsive Ferrocenyl Amphiphilic PAMAM Dendrimers for On–Demand Delivery of siRNA Therapeutics to Cancer Cells

doi: 10.3390/pharmaceutics16070936

Figure Lengend Snippet: Schematic presentation of ferrocenyl amphiphilic dendrimer-mediated siRNA delivery. ( A ) Chemical structure of the Fc-AmDs . ( B ) Cartoon illustration of Fc-AmD –mediated siRNA delivery.

Article Snippet: The human AKT2 siRNA (forward primer: 5′–GCUCCUUCAUUGGGUACAAdTdT–3′; reverse primer: 5′–UAAUGUGCCCGUCCUUGUCdTdT–3′) and GAPDH (forward primer: 5′–AATCCCATCACCATCTTCCA–3′; reverse primer: 5′–TGGACTCCACGACGTACTCA–3′) were purchased from GenScript Biotech Corp. (Nanjing, China).

Techniques:

Journal: Pharmaceutics

Article Title: ROS–Responsive Ferrocenyl Amphiphilic PAMAM Dendrimers for On–Demand Delivery of siRNA Therapeutics to Cancer Cells

doi: 10.3390/pharmaceutics16070936

Figure Lengend Snippet: ( A ) The CAC values of the Fc-AmDs were determined using fluorescent probe pyrene. ( B ) Gel retardation assay of siRNA with Fc-AmDs at N/P ratios ranging from 0.2 to 10 (200 ng siRNA per well). ( C ) AKT2 protein expression on SKOV–3 cells determined by Western blotting after treating with siAKT2/ Fc-AmDs complexes (50 nM siRNA, N/P ratio of 10). ( D ) siRNA release from the siRNA/ Fc-AmDs complexes was determined by heparin replacement assay (1.32 μg siRNA per well, N/P ratio of 10). *** p ≤ 0.001 (mean ± SD, n = 3).

Article Snippet: The human AKT2 siRNA (forward primer: 5′–GCUCCUUCAUUGGGUACAAdTdT–3′; reverse primer: 5′–UAAUGUGCCCGUCCUUGUCdTdT–3′) and GAPDH (forward primer: 5′–AATCCCATCACCATCTTCCA–3′; reverse primer: 5′–TGGACTCCACGACGTACTCA–3′) were purchased from GenScript Biotech Corp. (Nanjing, China).

Techniques: Electrophoretic Mobility Shift Assay, Expressing, Western Blot

Journal: Pharmaceutics

Article Title: ROS–Responsive Ferrocenyl Amphiphilic PAMAM Dendrimers for On–Demand Delivery of siRNA Therapeutics to Cancer Cells

doi: 10.3390/pharmaceutics16070936

Figure Lengend Snippet: ( A ) DLS analysis of the ROS–responsive disassembly of siRNA/ Fc-C 8 -AmD 8A nanoparticles (1.0 μM siRNA, N/P ratio of 10). ( B ) ROS–responsive siRNA delivery mediated by Fc-C 8 -AmD 8A in ROS–rich SKOV–3 cells and ROS–poor SKOV–3 cells (pretreated with antioxidant NAC) (50 nM siRNA, N/P ratio of 10). ( C ) mRNA and ( D ) protein expression of AKT2 determined by qRT–PCR and Western blot after treating with Fc-C 8 -AmD 8A with siAKT2 in comparison with control, siAKT2 alone, Fc-C 8 -AmD 8A alone, Fc-C 8 -AmD 8A with scrambled siRNA (50 nM siRNA, N/P ratio of 10). *** p ≤ 0.001 (mean ± SD, n = 3).

Article Snippet: The human AKT2 siRNA (forward primer: 5′–GCUCCUUCAUUGGGUACAAdTdT–3′; reverse primer: 5′–UAAUGUGCCCGUCCUUGUCdTdT–3′) and GAPDH (forward primer: 5′–AATCCCATCACCATCTTCCA–3′; reverse primer: 5′–TGGACTCCACGACGTACTCA–3′) were purchased from GenScript Biotech Corp. (Nanjing, China).

Techniques: Expressing, Quantitative RT-PCR, Western Blot, Comparison, Control

Journal: Pharmaceutics

Article Title: ROS–Responsive Ferrocenyl Amphiphilic PAMAM Dendrimers for On–Demand Delivery of siRNA Therapeutics to Cancer Cells

doi: 10.3390/pharmaceutics16070936

Figure Lengend Snippet: Fc-C 8 -AmD 8A –mediated siRNA delivery combines the beneficial properties of both lipid and dendrimer vectors. ( A ) Compared to Fc-C 8 -AmD 8A , neither the Fc alkyl chain entity Fc-C 8 -N 3 nor the dendron 8A led to any gene silencing with 50 nM siRNA at N/P ratio of 10. ( B ) Dioleoylphosphatidylethanolamine (DOPE) enhanced the gene silencing of AKT2 after treatment of siRNA/Fc-C 8 -AmD 8A complexes with 50 nM siRNA at N/P ratio of 10 on SKOV–3 cells. ( C ) The presence of bafilomycin A1 decreased the Fc-C 8 -AmD 8A –mediated gene silencing of AKT2 on SKOV–3 on cells (50 nM siRNA, N/P ratio of 10).

Article Snippet: The human AKT2 siRNA (forward primer: 5′–GCUCCUUCAUUGGGUACAAdTdT–3′; reverse primer: 5′–UAAUGUGCCCGUCCUUGUCdTdT–3′) and GAPDH (forward primer: 5′–AATCCCATCACCATCTTCCA–3′; reverse primer: 5′–TGGACTCCACGACGTACTCA–3′) were purchased from GenScript Biotech Corp. (Nanjing, China).

Techniques: